|
Left Crispr |
Right Crispr |
| Crispr ID |
960798525 |
960798530 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:121514068-121514090
|
3:121514083-121514105
|
| Sequence |
CCTGTAATTCCAGCACTGTGGGA |
CTGTGGGAGGCCAAGGTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 90, 1: 14432, 2: 313545, 3: 258591, 4: 143399} |
{0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|