ID: 960807542_960807553

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 960807542 960807553
Species Human (GRCh38) Human (GRCh38)
Location 3:121598626-121598648 3:121598674-121598696
Sequence CCATTGCACTACACCGGGTGAGC TGGTGGAGATGGAAAGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 39} {0: 1, 1: 1, 2: 9, 3: 93, 4: 720}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!