ID: 960837837_960837842

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 960837837 960837842
Species Human (GRCh38) Human (GRCh38)
Location 3:121925869-121925891 3:121925906-121925928
Sequence CCTGCCAAAGCCAACAGATTTCT GGTAAAGCATGTACAGCACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 202} {0: 1, 1: 0, 2: 2, 3: 22, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!