ID: 960864366_960864382

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 960864366 960864382
Species Human (GRCh38) Human (GRCh38)
Location 3:122184569-122184591 3:122184606-122184628
Sequence CCCTGGTGGGGGAGGGGCCGTGG CAAGGGCTCCGGGCCGAACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 101, 4: 487} {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!