ID: 960864376_960864388

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 960864376 960864388
Species Human (GRCh38) Human (GRCh38)
Location 3:122184586-122184608 3:122184634-122184656
Sequence CCGTGGCGGGGTCTGGGGGCCAA ACGCCGGAGCAGCTCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 207} {0: 1, 1: 0, 2: 0, 3: 14, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!