ID: 960875286_960875294

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 960875286 960875294
Species Human (GRCh38) Human (GRCh38)
Location 3:122289583-122289605 3:122289618-122289640
Sequence CCAACAGGGCAGGAAGCCGGGCA AGGTGCCTCTGGGAACTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 206} {0: 1, 1: 0, 2: 4, 3: 28, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!