ID: 960939122_960939135

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 960939122 960939135
Species Human (GRCh38) Human (GRCh38)
Location 3:122922186-122922208 3:122922208-122922230
Sequence CCGTCCCTCAACCCACCCCCGAC CCTGCAGTCCAGGTTGGACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 985} {0: 1, 1: 0, 2: 2, 3: 17, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!