ID: 960955171_960955185

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 960955171 960955185
Species Human (GRCh38) Human (GRCh38)
Location 3:123026649-123026671 3:123026683-123026705
Sequence CCCTCTCTGTGCCCGAGCGCCCC CTCCTCGCTGGATCTCCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 179} {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!