ID: 960955461_960955478

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 960955461 960955478
Species Human (GRCh38) Human (GRCh38)
Location 3:123027734-123027756 3:123027774-123027796
Sequence CCCGACCCGGCGCTCGGAGAGAG CGGGAGCAGAAGGAGGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69} {0: 1, 1: 0, 2: 17, 3: 198, 4: 1639}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!