ID: 960963914_960963918

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 960963914 960963918
Species Human (GRCh38) Human (GRCh38)
Location 3:123091488-123091510 3:123091517-123091539
Sequence CCACAGCCACTTTGCAGTGGATC GGCTGGCAGTGCTGAAATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 166} {0: 1, 1: 0, 2: 2, 3: 30, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!