ID: 960964874_960964879

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 960964874 960964879
Species Human (GRCh38) Human (GRCh38)
Location 3:123097777-123097799 3:123097793-123097815
Sequence CCACCTGGCCAGAAGCTTGCCAT TTGCCATGTTAGACCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 157} {0: 1, 1: 0, 2: 1, 3: 4, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!