ID: 960964880_960964891

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 960964880 960964891
Species Human (GRCh38) Human (GRCh38)
Location 3:123097796-123097818 3:123097844-123097866
Sequence CCATGTTAGACCAGGGCTGGTGG ATGGGGAAATGGAACTAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 210} {0: 1, 1: 0, 2: 2, 3: 33, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!