ID: 960970872_960970878

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 960970872 960970878
Species Human (GRCh38) Human (GRCh38)
Location 3:123139283-123139305 3:123139323-123139345
Sequence CCAGGAGGCTGGTCCTCAGGTCA CACCCACGGCTCCCCAAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 223} {0: 1, 1: 0, 2: 1, 3: 16, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!