|
Left Crispr |
Right Crispr |
| Crispr ID |
960981533 |
960981536 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:123232548-123232570
|
3:123232584-123232606
|
| Sequence |
CCAAAAAAACAGTAAAGGGCCAG |
CACCTGTAATCCCACCACTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 1, 3: 33, 4: 312} |
{0: 598, 1: 76344, 2: 216768, 3: 254686, 4: 200866} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|