ID: 960994529_960994537

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 960994529 960994537
Species Human (GRCh38) Human (GRCh38)
Location 3:123332242-123332264 3:123332275-123332297
Sequence CCCTGGGGTTTGGGCAGTGTGAC CACCACCCGCTTCCAAGGATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 204} {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!