ID: 961012694_961012700

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 961012694 961012700
Species Human (GRCh38) Human (GRCh38)
Location 3:123447135-123447157 3:123447169-123447191
Sequence CCTTCCTCACTGCATTCCCACAG GTTCAGTACACGTTATCTAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 54, 4: 473} {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!