ID: 961012921_961012924

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 961012921 961012924
Species Human (GRCh38) Human (GRCh38)
Location 3:123448142-123448164 3:123448156-123448178
Sequence CCGCCCGCAGGGGGCGCCCGGGT CGCCCGGGTGCTGCCCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 150} {0: 1, 1: 0, 2: 1, 3: 14, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!