ID: 961013408_961013424

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 961013408 961013424
Species Human (GRCh38) Human (GRCh38)
Location 3:123449823-123449845 3:123449868-123449890
Sequence CCCGGGCCTCGGCTCACAGCCGC CCTGGCCATGGCCCCAGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 263} {0: 1, 1: 0, 2: 6, 3: 98, 4: 711}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!