ID: 961013429_961013438

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 961013429 961013438
Species Human (GRCh38) Human (GRCh38)
Location 3:123449880-123449902 3:123449901-123449923
Sequence CCCAGCCTCGGCGCCCCGCGGGC GCATCCTCAGGCCTGGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 217} {0: 1, 1: 1, 2: 0, 3: 37, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!