ID: 961013431_961013437

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 961013431 961013437
Species Human (GRCh38) Human (GRCh38)
Location 3:123449885-123449907 3:123449900-123449922
Sequence CCTCGGCGCCCCGCGGGCATCCT GGCATCCTCAGGCCTGGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 205} {0: 1, 1: 0, 2: 4, 3: 28, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!