ID: 961057483_961057486

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 961057483 961057486
Species Human (GRCh38) Human (GRCh38)
Location 3:123801330-123801352 3:123801354-123801376
Sequence CCATCTACTCTCATTTCTGTCCT CTTAAAATACACAAGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 60, 4: 569} {0: 1, 1: 1, 2: 2, 3: 42, 4: 456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!