ID: 961091929_961091932

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 961091929 961091932
Species Human (GRCh38) Human (GRCh38)
Location 3:124120202-124120224 3:124120218-124120240
Sequence CCCCGACAGGGCAGGTGGCTCTG GGCTCTGACTCCTGAGTTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 195} {0: 1, 1: 2, 2: 15, 3: 269, 4: 2398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!