|
Left Crispr |
Right Crispr |
| Crispr ID |
961095678 |
961095682 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:124154257-124154279
|
3:124154288-124154310
|
| Sequence |
CCAGGGCAATTAGGCAGGAGAAG |
GGGTATTCAATTACAAAAACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3432, 1: 3970, 2: 2749, 3: 4464, 4: 5213} |
{0: 1, 1: 7, 2: 186, 3: 7530, 4: 4257} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|