ID: 961111849_961111851

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 961111849 961111851
Species Human (GRCh38) Human (GRCh38)
Location 3:124291029-124291051 3:124291053-124291075
Sequence CCATGGGCCATCTTGGGTACTGA CTACTGAGAATGATAGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111} {0: 1, 1: 0, 2: 2, 3: 22, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!