ID: 961115353_961115359

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 961115353 961115359
Species Human (GRCh38) Human (GRCh38)
Location 3:124324359-124324381 3:124324376-124324398
Sequence CCCTCCCCATTCTTCCTCTCTAT CTCTATTTCTAAGTGCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 94, 4: 1110} {0: 1, 1: 0, 2: 2, 3: 9, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!