ID: 961134112_961134115

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 961134112 961134115
Species Human (GRCh38) Human (GRCh38)
Location 3:124494332-124494354 3:124494350-124494372
Sequence CCACAGTCCTAGGTGGCCTCCCC TCCCCACATCCCCCCAGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 215} {0: 1, 1: 0, 2: 5, 3: 39, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!