ID: 961150419_961150425

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 961150419 961150425
Species Human (GRCh38) Human (GRCh38)
Location 3:124632903-124632925 3:124632925-124632947
Sequence CCAGCAGACAGAAACCATTTGCC CAGATTTGGAGATAGGACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 219} {0: 1, 1: 0, 2: 0, 3: 21, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!