ID: 961168554_961168569

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 961168554 961168569
Species Human (GRCh38) Human (GRCh38)
Location 3:124780085-124780107 3:124780122-124780144
Sequence CCCTCAGCGAGGCCTCTGAGGCA TCAGGGAGGCCTCTGAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 221} {0: 1, 1: 1, 2: 5, 3: 65, 4: 489}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!