ID: 961173768_961173779

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 961173768 961173779
Species Human (GRCh38) Human (GRCh38)
Location 3:124817540-124817562 3:124817564-124817586
Sequence CCTGAGCCCGCGGCAGCTGCAGG CCTCAGTGGGAGAGGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 376} {0: 1, 1: 0, 2: 3, 3: 52, 4: 590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!