ID: 961175220_961175228

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 961175220 961175228
Species Human (GRCh38) Human (GRCh38)
Location 3:124829893-124829915 3:124829939-124829961
Sequence CCTCTCAGTTCCTTAAAATCTGA AAGGGGAAGCAGGAATGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 264} {0: 1, 1: 0, 2: 11, 3: 125, 4: 1191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!