ID: 961183441_961183446

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 961183441 961183446
Species Human (GRCh38) Human (GRCh38)
Location 3:124894574-124894596 3:124894624-124894646
Sequence CCTCTTTCCGCTGGAGCAAAGCA TGTTTTCTCATATCACCTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 96} {0: 1, 1: 0, 2: 1, 3: 16, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!