ID: 961200108_961200115

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 961200108 961200115
Species Human (GRCh38) Human (GRCh38)
Location 3:125038771-125038793 3:125038806-125038828
Sequence CCTGCTCTTATTCTTGGTGGAGA CTGGAGAAATGGAAAGGAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 173} {0: 1, 1: 0, 2: 11, 3: 109, 4: 864}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!