ID: 961253938_961253941

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 961253938 961253941
Species Human (GRCh38) Human (GRCh38)
Location 3:125530610-125530632 3:125530646-125530668
Sequence CCCTCTAATATTATCAAAATCAG AAGCAACACCTTCACTGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 309} {0: 1, 1: 0, 2: 0, 3: 21, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!