ID: 961259801_961259813

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 961259801 961259813
Species Human (GRCh38) Human (GRCh38)
Location 3:125593156-125593178 3:125593182-125593204
Sequence CCCACCCACAGCCCCATAGCAGG GGACGAAGCGCCACGGACAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 34, 4: 390} {0: 1, 1: 1, 2: 0, 3: 3, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!