ID: 961259805_961259814

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 961259805 961259814
Species Human (GRCh38) Human (GRCh38)
Location 3:125593161-125593183 3:125593190-125593212
Sequence CCACAGCCCCATAGCAGGTCAGG CGCCACGGACAGGGGACCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 225} {0: 2, 1: 0, 2: 1, 3: 9, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!