ID: 961265041_961265052

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 961265041 961265052
Species Human (GRCh38) Human (GRCh38)
Location 3:125634882-125634904 3:125634927-125634949
Sequence CCTGGCTTATGGGTGGGTTTAGA GGGGAGAAGGAAGATGGGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 20, 3: 170, 4: 1552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!