ID: 961300102_961300109

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 961300102 961300109
Species Human (GRCh38) Human (GRCh38)
Location 3:125916611-125916633 3:125916625-125916647
Sequence CCCCGCCCACGTCATGGCGCCCG TGGCGCCCGAGGAGAACGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 3, 3: 1, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!