ID: 961308231_961308241

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 961308231 961308241
Species Human (GRCh38) Human (GRCh38)
Location 3:125974711-125974733 3:125974761-125974783
Sequence CCCCCAAACAAAGTCCACTCCAC CTGAAAATTTTGAGGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 144} {0: 2, 1: 0, 2: 0, 3: 45, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!