ID: 961316025_961316032

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 961316025 961316032
Species Human (GRCh38) Human (GRCh38)
Location 3:126036287-126036309 3:126036324-126036346
Sequence CCTGTAAGGATGGCATCAACAAG CTTGCCCTTTCACTTCTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 116} {0: 1, 1: 0, 2: 8, 3: 46, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!