ID: 961317747_961317757

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 961317747 961317757
Species Human (GRCh38) Human (GRCh38)
Location 3:126052155-126052177 3:126052206-126052228
Sequence CCTCTCTTAAAACTTGAGAAGAA CACACCTCACAGTCTCCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 355} {0: 1, 1: 0, 2: 3, 3: 19, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!