ID: 961344170_961344185

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 961344170 961344185
Species Human (GRCh38) Human (GRCh38)
Location 3:126251120-126251142 3:126251167-126251189
Sequence CCCCCTAAAATGTATAAAAACTA CATGTTCTCAGGGTCTCCTGAGG
Strand - +
Off-target summary No data {0: 46, 1: 209, 2: 641, 3: 795, 4: 1294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!