ID: 961344171_961344186

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 961344171 961344186
Species Human (GRCh38) Human (GRCh38)
Location 3:126251121-126251143 3:126251168-126251190
Sequence CCCCTAAAATGTATAAAAACTAG ATGTTCTCAGGGTCTCCTGAGGG
Strand - +
Off-target summary No data {0: 41, 1: 166, 2: 469, 3: 387, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!