ID: 961365309_961365311

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 961365309 961365311
Species Human (GRCh38) Human (GRCh38)
Location 3:126395709-126395731 3:126395744-126395766
Sequence CCGAAAATGCAAAGGCTTGAGGC GTTCTAAGCACAGAAAAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 184} {0: 1, 1: 0, 2: 4, 3: 29, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!