ID: 961365634_961365642

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 961365634 961365642
Species Human (GRCh38) Human (GRCh38)
Location 3:126397803-126397825 3:126397843-126397865
Sequence CCAAAATGACACTGAGCCACCTG ATGCTGAGCCAAGTACAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 144} {0: 1, 1: 0, 2: 0, 3: 1, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!