ID: 961373593_961373600

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 961373593 961373600
Species Human (GRCh38) Human (GRCh38)
Location 3:126448035-126448057 3:126448065-126448087
Sequence CCTCAGCTTTCTCATCCAGAAAG CACGAGGACCTACACCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 31, 3: 254, 4: 1606} {0: 1, 1: 0, 2: 0, 3: 6, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!