ID: 961377238_961377249

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 961377238 961377249
Species Human (GRCh38) Human (GRCh38)
Location 3:126475360-126475382 3:126475392-126475414
Sequence CCGGAGGCCTGGGGCGCGCGGCG GGCGCCCGCGGTTGCGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 216} {0: 1, 1: 0, 2: 4, 3: 35, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!