ID: 961388101_961388114

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 961388101 961388114
Species Human (GRCh38) Human (GRCh38)
Location 3:126535902-126535924 3:126535954-126535976
Sequence CCCCACAAGGGTTGGGGCATGAG GGTGATCTGGCCTTTCCTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 120} {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!