ID: 961399697_961399702

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 961399697 961399702
Species Human (GRCh38) Human (GRCh38)
Location 3:126629999-126630021 3:126630030-126630052
Sequence CCAGGTAATGCAAGTGCACAGAA GGACCCAGAGGAAAACAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155} {0: 1, 1: 1, 2: 0, 3: 29, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!