ID: 961414141_961414149

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 961414141 961414149
Species Human (GRCh38) Human (GRCh38)
Location 3:126745156-126745178 3:126745195-126745217
Sequence CCTGGACACGTGACTGCCCCAAA TTATTAAAGAAGAGGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 100} {0: 1, 1: 0, 2: 4, 3: 81, 4: 731}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!