ID: 961428865_961428869

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 961428865 961428869
Species Human (GRCh38) Human (GRCh38)
Location 3:126865703-126865725 3:126865717-126865739
Sequence CCCTCTTCCCTGAGTCTACTCTG TCTACTCTGCATACTGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 364} {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!